View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17574_high_71 (Length: 231)
Name: NF17574_high_71
Description: NF17574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17574_high_71 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 6011232 - 6011445
Alignment:
| Q |
1 |
aactctccatagatttgtatgcatagagactaattcatcaaaagctacctactgatgacaatatagcaaagagaggatgttacttgccttctgtctgtac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6011232 |
aactctccatagatttgtatgcatagagactaattcatcaaaagctacctactgatgacaatttagtaaagagaggatgttacttgccttctgtctgtac |
6011331 |
T |
 |
| Q |
101 |
catgtgccaaaagcaagctgaaacttctgatcacttatttttgcagtgcgactttgcaatttatctatggcaatggctgatatctattttaaaaatgaat |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6011332 |
catgtgccaaaagcaagttgaaacttctgatcacttatttttgcagtgcgactttgcaatttatctatggcaatggctgatatctattttaaaaatgaat |
6011431 |
T |
 |
| Q |
201 |
atcaatctatcctc |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6011432 |
atcaatctatcctc |
6011445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University