View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17574_high_76 (Length: 218)
Name: NF17574_high_76
Description: NF17574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17574_high_76 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 22 - 206
Target Start/End: Complemental strand, 34110825 - 34110641
Alignment:
| Q |
22 |
atgatgagcactaatataggtagagtagagcagatatatattcctaatgttttttcaattagcactaattgttgttacaaacaaaaagaagagcttcatt |
121 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34110825 |
atgatgagcagtaatataggtagagtagagcagatatatattcctaatgttttttcaattagcactaattgttgttacaaacaaaaagaagagcttcatt |
34110726 |
T |
|
| Q |
122 |
aaccagttaggtagtaaataacactagttgagctgttgaagtagtaaccaaaatcataaactggttatgctgctggagaataatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34110725 |
aaccagttaggtagtaaataacactagttgagctgttgaagtagtaaccaaaatcataaactggttatgctgctggagcataatc |
34110641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University