View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17574_high_79 (Length: 204)
Name: NF17574_high_79
Description: NF17574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17574_high_79 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 38442065 - 38442199
Alignment:
| Q |
1 |
gtatatgcccagaaatgaggatggatatatatcatttagaagaagaagaagaatagtactaatattcttattttatgggtagcacttctgtgacattgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||| ||||||||| |
|
|
| T |
38442065 |
gtatatgcccagaaatgaggatggatatatatcatttagaa---gaagaagaatagtactaatatgtttattttacgggtagcacttctgcgacattgtg |
38442161 |
T |
|
| Q |
101 |
aagctcatgttatctagctaacacgtggtacctacttt |
138 |
Q |
| |
|
||||| |||| |||||||||||| | | |||||||||| |
|
|
| T |
38442162 |
aagctaatgtcatctagctaacatgagatacctacttt |
38442199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University