View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17574_low_30 (Length: 356)
Name: NF17574_low_30
Description: NF17574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17574_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 17 - 338
Target Start/End: Original strand, 16456377 - 16456698
Alignment:
| Q |
17 |
acctgtgccattcatcatactctacctgaaacgatttgcatctttcctcgcttccaagagcccttcggcatcacgattcctcgacattttgttcaagaat |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16456377 |
acctgtgccgttcatcatactctacctgaaacgatttgcatctttcctcgcttccaagagcccttcggcatcacgattcctcgacattttgttcaagaat |
16456476 |
T |
 |
| Q |
117 |
gccaaagcaaaggctggaccagtggaggagtttcagtggcttggtctgatgctctttgtcgctgtcccgtttcccggcacaggagcatggtctggagcca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16456477 |
gccaaagcaaaggctggaccagtggaggagtttcagtggcttggtctgatgctctttgtcgctgtcccgtttcccggcacaggagcatggtctggagcca |
16456576 |
T |
 |
| Q |
217 |
ttatagcatcaatccttgatatgccgttttggccagcagtgtctgcgaatttcttcggcgttgtatttgccgggatgctcgtaaatttgctagtgaatct |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16456577 |
ttatagcatcaatccttgatatgccgttttggccagcagtgtctgcgaatttcttcggcgttgtatttgccgggatgctcgtaaatttgctagtgaatct |
16456676 |
T |
 |
| Q |
317 |
tggtctgaagtatgcaatcatt |
338 |
Q |
| |
|
||||||||||||||| |||||| |
|
|
| T |
16456677 |
tggtctgaagtatgccatcatt |
16456698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University