View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17574_low_40 (Length: 324)
Name: NF17574_low_40
Description: NF17574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17574_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 4e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 13 - 143
Target Start/End: Original strand, 18053575 - 18053705
Alignment:
| Q |
13 |
tgaatcccttgtcctgacactcagtatagtcacaatgttgggctcatagcttgcgaagcaaggtagacaatggcaaacaccttgtatgattttcatatct |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18053575 |
tgaatcccttgtcctgacactcagtatagtcacaatgttgggctcatagcttgcgaaccaaggtagacaatggcgaacaccttgtatgattttcatatct |
18053674 |
T |
|
| Q |
113 |
cgcgatgcggggctcataaagttggtcgata |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18053675 |
cgcgatgcggggctcataaagttggtcgata |
18053705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University