View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17574_low_41 (Length: 322)
Name: NF17574_low_41
Description: NF17574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17574_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 5 - 212
Target Start/End: Original strand, 46393758 - 46393952
Alignment:
| Q |
5 |
atggaatgtgtgaagttgttgtctagtgtttctttgctggaaaatgtgaaagatacttggtcttggaatcataaaacatgataattctatttggtcaaag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46393758 |
atggaatgtgtgaagttgttgtctagtgtttctttgctggaaaatgtgaaagatacttggtcttggaatcataaaacatgataattctatttggtcaaag |
46393857 |
T |
 |
| Q |
105 |
aagcttatcatatgatcggatcatatgacaatttcgatgattcttcgttaggtaacgtgtcttgacacaaaattgatacctatgaagatattgttatttg |
204 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46393858 |
aagctt-------------atcatatgacaatttcgatgattcttcgttaggtaacgtgtcttgacacaaaattgatacctatgaaggtattgttatttg |
46393944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 255 - 302
Target Start/End: Original strand, 46393950 - 46393997
Alignment:
| Q |
255 |
agaagtgtttcatatttatattcccctttatacttgtcttatagtggt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46393950 |
agaagtgtttcatatttatattccccttgatacttgtcttatagtggt |
46393997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University