View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17574_low_54 (Length: 267)
Name: NF17574_low_54
Description: NF17574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17574_low_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 693075 - 692826
Alignment:
| Q |
1 |
ttctggtgttctttcacaaaagggtgttcttcttcgtggtgatcgagatgcttcttccatggaagagttgcagagtgctattcaaggtgctattactcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
693075 |
ttctggtgttctttcacaaaagggtgttcttcttcgtggtgatcgagatgcttcttccatggaagagttgcagagtgctattcaaggtgctattactcat |
692976 |
T |
 |
| Q |
101 |
tgcaaaaactctttgattacgaataaacatggggttagtagtaatcatgaaattaatctcatctaactgttttgtaatttgttcaattggtgtttcattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
692975 |
tgcaaaaactctttgattacgaataaacatggggttagtagtaatcatgaaattaatctcatctaactg--ttgtaatttgttcaattggtgtttcattt |
692878 |
T |
 |
| Q |
201 |
actctttagtataatatagtatgcagtctatgaagcaccgacacccacatat |
252 |
Q |
| |
|
||||||||||||||| ||| || | ||||||||||||||||||||||||||| |
|
|
| T |
692877 |
actctttagtataatgtagcatcccgtctatgaagcaccgacacccacatat |
692826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University