View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17574_low_63 (Length: 250)
Name: NF17574_low_63
Description: NF17574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17574_low_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 42686899 - 42686660
Alignment:
| Q |
1 |
atcctcaacattttcattctctcctttccaaattccaaaccaggaattattgacatacactctccaccttgtgagggtattagataaataagtttgttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42686899 |
atcctcaacattttcattctctcctttccaaattccaaaccaggaattattgacatacactctccaccttgtgagggtattagataaataagtttgttgt |
42686800 |
T |
 |
| Q |
101 |
atactttaccttgggttagttagtttgattggttagcttagttaattgtttagcctaaccctatgatttatttcttgatcttgggttagttagtttactt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42686799 |
atactttaccttgggttagttagtttgattggttagcttagttaattgtttagcctaaccctatgatttatttcttgatcttgggttagttagtttactt |
42686700 |
T |
 |
| Q |
201 |
agtctgttaggttagtcagtgctttagcctataccctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42686699 |
agtctgttaggttagtcagtgctttagcctataccctatg |
42686660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 76 - 191
Target Start/End: Complemental strand, 42688074 - 42687955
Alignment:
| Q |
76 |
ggtattagataaataagtttgttgtatactttaccttgggttagt----tagtttgattggttagcttagttaattgtttagcctaaccctatgatttat |
171 |
Q |
| |
|
|||||||||||||||| | || ||||||||||||||||||||| ||||||| |||||||||||||||| |||||||||||| |||| |||| ||| |
|
|
| T |
42688074 |
ggtattagataaataattctgccctatactttaccttgggttagtaagttagtttgcttggttagcttagttagttgtttagcctagccctctgatgtat |
42687975 |
T |
 |
| Q |
172 |
ttcttgatcttgggttagtt |
191 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
42687974 |
tttttgatcttgggttagtt |
42687955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University