View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17574_low_66 (Length: 248)
Name: NF17574_low_66
Description: NF17574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17574_low_66 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 46440950 - 46441187
Alignment:
| Q |
1 |
taacttttacttttaaattttttaattcatattaataagttggtta-tatctgtgtctcgtatcaacttacaagtgggaattagagtgtgagttttcaag |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46440950 |
taacttttatttttaaattttttaattcatattaataagttggttagtatctgtgtctcgtatcaacttacaagcgggaattagagtgtgagttttcaag |
46441049 |
T |
 |
| Q |
100 |
tagtaataattgtttagttttgattgaggtttgaacctcgacgtccgaagagtgtgggttttcaagtggcatgaaattctttaaaaagaaaggttaatta |
199 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46441050 |
tagtaataattgtttagctttgattgaggtttgaacctcgacctcggaagagtgtgggttttcaagtggcatgaaattctttaaaaagaaaggttaatta |
46441149 |
T |
 |
| Q |
200 |
gtagtaccactgtgtttggttggggaagttatgatatt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46441150 |
gtagtaccactgtgtttggttggggaagttatgatatt |
46441187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University