View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17574_low_75 (Length: 222)
Name: NF17574_low_75
Description: NF17574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17574_low_75 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 19 - 207
Target Start/End: Original strand, 38892902 - 38893090
Alignment:
| Q |
19 |
attcttgggtccactttttgcagggaaggcaagaagagagaaacagaaggcaactagtgactttagattgaaaagtaatggcaaaggagcaaattcaggt |
118 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38892902 |
attcttggttccactttttgcagggaaggcaagaagagagaaacagaaggaaactagtgactttagattgaaaagtaatggcaaaggagcaaattcaggt |
38893001 |
T |
 |
| Q |
119 |
gctaaatgcacttgatgtggcgaaaacgcaatggtatcacttcacagcaatcatcatagctggaatgggattctttacggatgcctatg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
38893002 |
gctaaatgcacttgatgtggcgaaaacgcaatggtatcacttcacagcaatcatcattgctggaatgggattctttactgatgcctatg |
38893090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 86 - 207
Target Start/End: Original strand, 38883777 - 38883898
Alignment:
| Q |
86 |
ttgaaaagtaatggcaaaggagcaaattcaggtgctaaatgcacttgatgtggcgaaaacgcaatggtatcacttcacagcaatcatcatagctggaatg |
185 |
Q |
| |
|
||||| ||| ||||| ||||| |||||||||||||||||||| ||||||||||| ||||| |||||||| || ||||| ||||||||||||||||| ||| |
|
|
| T |
38883777 |
ttgaatagtcatggctaaggatcaaattcaggtgctaaatgcgcttgatgtggctaaaacacaatggtaccatttcactgcaatcatcatagctggtatg |
38883876 |
T |
 |
| Q |
186 |
ggattctttacggatgcctatg |
207 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
38883877 |
ggattctttacagatgcctatg |
38883898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 114 - 202
Target Start/End: Complemental strand, 30621081 - 30620993
Alignment:
| Q |
114 |
caggtgctaaatgcacttgatgtggcgaaaacgcaatggtatcacttcacagcaatcatcatagctggaatgggattctttacggatgc |
202 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||| || ||||||||||| |||||||||||||||| ||||| || ||||| |
|
|
| T |
30621081 |
caggtgctaaatgcactagatgtagcgaaaacacaatggtaccatttcacagcaattgtcatagctggaatgggcttcttcaccgatgc |
30620993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 117 - 207
Target Start/End: Original strand, 16223190 - 16223280
Alignment:
| Q |
117 |
gtgctaaatgcacttgatgtggcgaaaacgcaatggtatcacttcacagcaatcatcatagctggaatgggattctttacggatgcctatg |
207 |
Q |
| |
|
||||||||||||||||||||||| || || |||| |||||||||||| |||| | || ||||||||||||||||| || ||||| |||| |
|
|
| T |
16223190 |
gtgctaaatgcacttgatgtggccaagacacaattgtatcacttcactacaattgtgattgctggaatgggattcttcactgatgcatatg |
16223280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University