View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17574_low_78 (Length: 218)
Name: NF17574_low_78
Description: NF17574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17574_low_78 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 8881825 - 8882025
Alignment:
| Q |
1 |
gtcggtagagcatttctgtcttaagaacacaacctggttttccatgaccctactaagtaacttggctgcatatgnnnnnnnnccttctgcatatgtgata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8881825 |
gtcggtagagcatttctgtcttaagaacacaacctggttttccatgaccctactaagtaacttggctgcatatgttttttttccttctgcatatgtgata |
8881924 |
T |
|
| Q |
101 |
tgtcgacaaattatatcaacaaatttttgttcatcttcataagttgtatttacaaagaggttttttagataaatgttatgtta-ttttttaatgtaatat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8881925 |
tgtcgacaaattatatcaacaaatttttgttcatcttcataagttgtatttacaaagagtttttttagataaatgttatgttatttttttaatgtaatat |
8882024 |
T |
|
| Q |
200 |
t |
200 |
Q |
| |
|
| |
|
|
| T |
8882025 |
t |
8882025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University