View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17574_low_80 (Length: 204)

Name: NF17574_low_80
Description: NF17574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17574_low_80
NF17574_low_80
[»] chr8 (1 HSPs)
chr8 (1-138)||(38442065-38442199)


Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 38442065 - 38442199
Alignment:
1 gtatatgcccagaaatgaggatggatatatatcatttagaagaagaagaagaatagtactaatattcttattttatgggtagcacttctgtgacattgtg 100  Q
    |||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||  |||||||| |||||||||||||| |||||||||    
38442065 gtatatgcccagaaatgaggatggatatatatcatttagaa---gaagaagaatagtactaatatgtttattttacgggtagcacttctgcgacattgtg 38442161  T
101 aagctcatgttatctagctaacacgtggtacctacttt 138  Q
    ||||| |||| |||||||||||| | | ||||||||||    
38442162 aagctaatgtcatctagctaacatgagatacctacttt 38442199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University