View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17575_low_2 (Length: 382)
Name: NF17575_low_2
Description: NF17575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17575_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 13 - 366
Target Start/End: Complemental strand, 55171362 - 55171009
Alignment:
| Q |
13 |
aaaatagagataatgattgttgacagagatacaatctgcagttacattacagagaacagtcctgccaatgtcaattcttggggatctaagaacggagaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55171362 |
aaaatagagataatgattgttgacagagatacaatctgcagttacattacagagaacagtcctgccaatgtcaattcttggggatctaagaacggagaat |
55171263 |
T |
 |
| Q |
113 |
ttcgttctgttggcaaaaattctggaccacaagcttcactgaaatgtcccagcggaaaaaagattgttgctgtcgagtttgcaagctttggtaatcctag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55171262 |
ttcgttctgttggcaaaaattctggaccacaagcttcactgaaatgtcccagcggcaaaaagattgttgctgtcgagtttgcaagctttggtaatcctag |
55171163 |
T |
 |
| Q |
213 |
tggttactgtggagattttgctattggaaattgtaacggtggtgctgctaagggtgttgttgagaaggcatgcttggggaaagaagaatgtttggttgaa |
312 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55171162 |
tggttactgtggagattttgctcttggaaattgtaacggtggtgctgctaagggtgttgttgagaaggcatgcttggggaaagaagaatgtttggttgaa |
55171063 |
T |
 |
| Q |
313 |
gtgaaccgtgcaaacttcaacggtcagggctgcgcaggttcagtgaatacactt |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55171062 |
gtgaaccgtgcaaacttcaacggtcagggctgcgcaggttcagtgaatacactt |
55171009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University