View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17575_low_3 (Length: 254)
Name: NF17575_low_3
Description: NF17575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17575_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 34 - 234
Target Start/End: Complemental strand, 1058020 - 1057820
Alignment:
| Q |
34 |
tattataaagaagaaaataatcatatcatacatcattcattatcttctcaatggctgtttcttactcattcttgccactaagcttcttctttttcctctt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1058020 |
tattataaagaagaaaataatcatatcatacatcattcattctcttctcaatggctgtttcttactcattcttggcactaagcttcttctttttcctctt |
1057921 |
T |
 |
| Q |
134 |
cacactctctccttttcctgtttctgctacagaccacattgtaggtgccaaccgtgggtggaaccctgggattaactacactctttgggctaataaccat |
233 |
Q |
| |
|
||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1057920 |
cacactctctcctttacctgtttccgctactgaccacattgtaggtgccaaccgtggctggaaccctgggattaactacactctttgggctaataaccat |
1057821 |
T |
 |
| Q |
234 |
a |
234 |
Q |
| |
|
| |
|
|
| T |
1057820 |
a |
1057820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University