View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17576_high_11 (Length: 506)
Name: NF17576_high_11
Description: NF17576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17576_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 376; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 11 - 459
Target Start/End: Original strand, 24777001 - 24777451
Alignment:
| Q |
11 |
acggcaccggatcacccttcttccaccatgcaattgaactaggatcaaactccgacggtgtcttcttcaaaagtgaaatccgtttcttcatttcaacaac |
110 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| || ||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24777001 |
acggcaccggttcacccttcttccaccatgcaaccgagctatgatcaaactccgacggtgtcttcttcaaaagtgaaatccgtttcttcacttcaacaac |
24777100 |
T |
 |
| Q |
111 |
attggtggaagaggacgaagaagatggagaagaagtcgaagaagttgatgtttggtgaggaagcttgataggagattcagtatcagggtttttgggagga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24777101 |
attggtggaagaggacgaagaagatggagaagaagtcgaagaagttgatgtttggtgaggaagcttgataggagattcagtatcagggtttttgggagga |
24777200 |
T |
 |
| Q |
211 |
atagggttgttgagtggttgaaagaatgtacgtatgcttttggagggagtggattgaaagtgatgagttttggttttcttgagaggaggttggtttttct |
310 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24777201 |
atagggctgttgagtggttgaaagaatgtacgtatgcttttggagggagtggattgaaggtgatgagttttggttttcttgagaggaggttggtttttct |
24777300 |
T |
 |
| Q |
311 |
tggccccggacatgataatgtcgaatacggagtggaggagactgccgtaagggtgaagctttgctgtggatataaccctaaacaaagccaggacgactat |
410 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24777301 |
tggcgccggacatgataacgtcgaatacggagtggaggaggctgccgtaggggtgaagctttgctgtggatacaaccctaaacaaagccaggacgactat |
24777400 |
T |
 |
| Q |
411 |
gtaacgttttcgc--ggttagggtttcagtgagagatttatacgtaaaagc |
459 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||| ||| ||||||| |
|
|
| T |
24777401 |
gtaacgttttcgcggggttagggtttcactgagagatttctacctaaaagc |
24777451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University