View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17576_high_65 (Length: 237)

Name: NF17576_high_65
Description: NF17576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17576_high_65
NF17576_high_65
[»] chr4 (1 HSPs)
chr4 (1-220)||(224127-224346)


Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 224127 - 224346
Alignment:
1 gcgcacgcattcaaaatttagcatttaagaaactaattgatgcaattattttctgcatgtgttatcaagaattagttaaccttgatgacaaagacactga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
224127 gcgcacgcattcaaaatttagcatttaagaaactaattgatgcaattattttctgcatgtgttatcaagaattagttaaccttgatgacaaagacactga 224226  T
101 aatagtttcggatcatggaccttgacaaggatttttaggatgttttgttttatggagatagagatatggctttagatatgtatgtagtactaatgcagca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
224227 aatagtttcggatcatggaccttgacaaggatttttaggatgttttgttttatggagatagagatatggctttagatatgtatgtagtactaatgcagca 224326  T
201 gtgtttttgcttacaaggaa 220  Q
    ||||||||||||||||||||    
224327 gtgtttttgcttacaaggaa 224346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University