View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17576_high_72 (Length: 216)
Name: NF17576_high_72
Description: NF17576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17576_high_72 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 44841311 - 44841101
Alignment:
| Q |
1 |
caagtttaggacgacgagatgtgtcaattttggaagaaagttttccaagttaaagctattgttgattatctccttt------------caattacaaaac |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44841311 |
caagtttaggacgacgagatgtgtcaattttggaagaaagttttccaagttaaagctattgttgattatctccttttaattggttattcaattacaaaac |
44841212 |
T |
 |
| Q |
89 |
atgatcaaatattggatgcaattatctgataatatgaagcatttctttctggtttcagaatctagacttgacaaaattataaagaattgcaactactttt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44841211 |
atgatcaaatattggatgcaattatctgataatatgaagcatttctatctggtttcagaatctagacttgacaaaattataaagaattgcaactactttt |
44841112 |
T |
 |
| Q |
189 |
tatgcgaaatt |
199 |
Q |
| |
|
||||||||||| |
|
|
| T |
44841111 |
tatgcgaaatt |
44841101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University