View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17576_low_31 (Length: 383)
Name: NF17576_low_31
Description: NF17576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17576_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 7 - 378
Target Start/End: Complemental strand, 36567278 - 36566907
Alignment:
| Q |
7 |
atatccagcgctgagcaacgctcatttgtagtagttgtgtgactcgaccactcacacttgagcacaacaattgttatctcttcaaacgtaacataacctt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |||||||| |||||||||||||||||||||||| || |
|
|
| T |
36567278 |
atatccagcgctgagcaacgctcatttgtagtagctgtgtgactcaaccactcacacttgagcccaacaattattatctcttcaaacgtaacataacttt |
36567179 |
T |
|
| Q |
107 |
atgtttctgctgtccatatttagcagatttgctgatattttataaaacaatggtttattctatcggcnnnnnnnagcatcattgtatattagtgttgggt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |||||||||||||||||| ||||||| |
|
|
| T |
36567178 |
atgtttctgctgtccatatttagcagatttgctgatattttataaaaccatggtttattctatccgctttttttagcatcattgtatattagagttgggt |
36567079 |
T |
|
| Q |
207 |
acttttggcatctatcatctatgaaatgtaataatgtattgctgtaccgatttaagactaatctcttagcaacttggatggctcagtttgagtttggtgg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36567078 |
acttttggcatctatcatctatgaaatgtaataatgtattgctgtaccgatttaagactaatctcttagcaacttggatggctcagtttgagtttggtag |
36566979 |
T |
|
| Q |
307 |
ttgtaatttgttgcaaactaaaccatttggtgggttaagtgcattatgtttggttatacttatttgaaccat |
378 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36566978 |
ttgtaatctgttgcaaactaaaccatttggtgggttaagtgcattatgtttggttatacttatttgaaccat |
36566907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University