View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17576_low_47 (Length: 310)
Name: NF17576_low_47
Description: NF17576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17576_low_47 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 28784910 - 28784622
Alignment:
| Q |
18 |
attgtttatatattaggcctctcaaattagtagtatactcacattattacatgcacaaaaccaaagaagcttaatatatagcttctcttttgggttccaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
28784910 |
attgtttatatattaggcctctcaaattagtagtatactcacattattacatgcacaaaaccaaagaagcttaata----gcttctcttttgagttccaa |
28784815 |
T |
 |
| Q |
118 |
gtgatctggtttaggaagtgtaatgcagattttcactctgcgccaaagagcacttttgtgcccttggctgtttgttgtctttttggtactaggtttttgc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28784814 |
gtgatctggtttaggaagtgtaatgcagattttcactctgcgccaaagagcacttttgtgctcttggctgtttgttgtctttttggtactaggtttttgc |
28784715 |
T |
 |
| Q |
218 |
tatggtggagaccatagtacagttgaggtagttgggcttggagaatgcgcagattgcattcagaacaatattaagactaaccaggctttctca |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28784714 |
tatggtggagaccatagtacagttgaggtagttgggcttggagaatgcgcagattgcattcagaacaatattaagactagccaggctttctca |
28784622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University