View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17576_low_48 (Length: 289)
Name: NF17576_low_48
Description: NF17576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17576_low_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 17 - 275
Target Start/End: Original strand, 1715066 - 1715324
Alignment:
| Q |
17 |
gtttgaggatttcaaacttgggtgaagcatgtggttcattatgcactacaagttctactaattacagcatttctcacctttactttttcaattatcttga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
1715066 |
gtttgaggatttcaaacttgggtgaagcatgtggttcattatgcactacaagttctactgatcctagcatttctcacttttactttttcaattatcttga |
1715165 |
T |
|
| Q |
117 |
aggaaaaactagaagaatataaaacactcagttgtaaatgaaaatttagtatgttcaatgcttagttatatattacttcttcagtgccatctctaccact |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1715166 |
aggaaaaactagaagaatataaaacactcagttgtaaatgaaaatttagtatgttcagtgcttagttatatattacttcttcagtgccatctctaccact |
1715265 |
T |
|
| Q |
217 |
ttattttcctccttcaagactaacgaaactgcttatccccgtggcattacctaattgtt |
275 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1715266 |
ttattttcctccttcaagaccaacgaaactgcttatccccgtggcattacctaattgtt |
1715324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University