View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17576_low_55 (Length: 263)
Name: NF17576_low_55
Description: NF17576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17576_low_55 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 6 - 252
Target Start/End: Original strand, 6523257 - 6523502
Alignment:
| Q |
6 |
atgtaatacgacatctattgcaacagaaagaccctccattctaaaataaatgatgtcttacgtattttttacaagcccttgataattgcaaacatagaag |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
6523257 |
atgtaatacgacatctattgcaacagaaagaccctccattctaaaataaatgatgtcttaggtattttttacaagcccttgatcattgcaa-catagaag |
6523355 |
T |
|
| Q |
106 |
ctcatgattcaaagaacaaccaatatggctattatttccttgaggctagattcttttcattattcaatctttctcctaataataattttttcatcatcac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6523356 |
ctcatgattcaaagaacaaccaatatggctattatttccttgaggctagattcttttcattattcaatctttctcctaataataattttttcatcatcac |
6523455 |
T |
|
| Q |
206 |
agttagccaaagccgataacacaacacaaaacttccactatttctgt |
252 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6523456 |
agttagccaaagctgataacacaacacaaaacttccactatttctgt |
6523502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University