View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17576_low_57 (Length: 258)
Name: NF17576_low_57
Description: NF17576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17576_low_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 32667596 - 32667342
Alignment:
| Q |
1 |
cgctaccacttgacatgtaactacaattgaggt----tgtatcaatcatatttgaccgtgattttcttttgtgcgaagaatcatgacacgaaaattatca |
96 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32667596 |
cgctgccacttgacatgtaaccacaattgaggtaggttgtatcaaccatatttgaccgtgattttcttttgtgcgaagaatcatgacacgaaaactatca |
32667497 |
T |
 |
| Q |
97 |
tcaccgcgaccacaatttagcacataacttattgaaagtgtgcagctagcaatatcaagtttcaaaatcagaaaatggcaagaggattgaaggttctatc |
196 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32667496 |
taaccgcgaccacaatttagcacataacttattgaaagtgtgcagctagcaatatcaagtttcaaaatcagaaaatggcaagaggattgaaggttctatc |
32667397 |
T |
 |
| Q |
197 |
agcccttgactcagcaaaaacacaatactaccatttcaaggccatcatcatagca |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32667396 |
agcccttgactcagcaaaaacacaatactaccatttcaaggccatcatcatagca |
32667342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University