View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17576_low_59 (Length: 250)
Name: NF17576_low_59
Description: NF17576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17576_low_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 149 - 237
Target Start/End: Complemental strand, 2940761 - 2940673
Alignment:
| Q |
149 |
ataatttttcctctcttgattataaggtttgatttgcctcaagcttataaataggttcaacctcatctcataatttcatcaaactcttc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2940761 |
ataatttttcctctcttgattataaggtttgatttgcctcaagcttataaataggttcaacctcgtctcataatttcatcaaactcttc |
2940673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 149 - 237
Target Start/End: Complemental strand, 2945698 - 2945610
Alignment:
| Q |
149 |
ataatttttcctctcttgattataaggtttgatttgcctcaagcttataaataggttcaacctcatctcataatttcatcaaactcttc |
237 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
2945698 |
ataatttttcctctcttgattttagggtttgatttgcctcaagcttataaataggttcaaccccatctcataatatcatcaaactcttc |
2945610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 44 - 88
Target Start/End: Complemental strand, 2940867 - 2940823
Alignment:
| Q |
44 |
agcgacaattattcatgaatttcatcgtcaatccttatccttatg |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2940867 |
agcgacaattattcatgaatttcatcgtcaatccttatccttatg |
2940823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 162 - 221
Target Start/End: Complemental strand, 2941321 - 2941262
Alignment:
| Q |
162 |
tcttgattataaggtttgatttgcctcaagcttataaataggttcaacctcatctcataa |
221 |
Q |
| |
|
|||||||| || |||||| || |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2941321 |
tcttgattctagggtttggttcgcctcaagcttataaataggttcaactccatctcataa |
2941262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 162 - 236
Target Start/End: Complemental strand, 2946531 - 2946456
Alignment:
| Q |
162 |
tcttgattataaggtttgatttgcctcaagcttataaataggttc-aacctcatctcataatttcatcaaactctt |
236 |
Q |
| |
|
|||||||| || || ||| |||||||||||||||||||||||||| |||| |||||||||| ||||||| ||||| |
|
|
| T |
2946531 |
tcttgattctagggcttggtttgcctcaagcttataaataggttcaaaccccatctcataacatcatcaagctctt |
2946456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 153 - 235
Target Start/End: Complemental strand, 2946111 - 2946030
Alignment:
| Q |
153 |
tttttcctctcttgattataaggtttgatttgcctcaagcttataaataggttcaacctcatctcataatttcatcaaactct |
235 |
Q |
| |
|
|||| ||| |||||||| || |||||| |||||||||||| ||||| ||||||||||| |||||||||| ||||||| |||| |
|
|
| T |
2946111 |
ttttacctttcttgattctagggtttggtttgcctcaagcgtataa-taggttcaaccccatctcataacatcatcaagctct |
2946030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 189 - 237
Target Start/End: Original strand, 21192791 - 21192839
Alignment:
| Q |
189 |
aagcttataaataggttcaacctcatctcataatttcatcaaactcttc |
237 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
21192791 |
aagcttataaataggtacaaccccatctcataatttcatcaaactcttc |
21192839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 162 - 221
Target Start/End: Original strand, 21192357 - 21192416
Alignment:
| Q |
162 |
tcttgattataaggtttgatttgcctcaagcttataaataggttcaacctcatctcataa |
221 |
Q |
| |
|
|||||||| || |||||| ||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21192357 |
tcttgattctagggtttggttttcctcaagcttataaataggttcaaccccatctcataa |
21192416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University