View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17576_low_63 (Length: 240)
Name: NF17576_low_63
Description: NF17576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17576_low_63 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 89 - 229
Target Start/End: Complemental strand, 33220054 - 33219914
Alignment:
| Q |
89 |
cttcgtgttttaagaaggaatatggtgaagatggaaggttgattttaaaggtggggaaagtgaagcgttattatgagcatatggaagcgaatcgagaaaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33220054 |
cttcgtgttttaagaaggaatatggtgaagatggaaggttgattttaaaggtggggaaagtgaagcgttattatgagcatatggaagcgaatagagaaaa |
33219955 |
T |
|
| Q |
189 |
tggtaggctcatcgtgaagctcatccatcatgatgatgatg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33219954 |
tggtaggctcatcgtgaagctcatccatcatgatgacgatg |
33219914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 14 - 63
Target Start/End: Complemental strand, 33220123 - 33220074
Alignment:
| Q |
14 |
agagagagaagaaggtttttccaccggcgataacgttgttgagagaaacc |
63 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33220123 |
agagagagaagaaggtttttccagcggcgataacgttgttgagagaaacc |
33220074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University