View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17576_low_66 (Length: 236)
Name: NF17576_low_66
Description: NF17576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17576_low_66 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 15 - 236
Target Start/End: Complemental strand, 33194001 - 33193783
Alignment:
| Q |
15 |
acaaaggaatctaattcaattaacaaaaagcaaatccttgttatttacatacaaatatgacagaaacaacacaagtagtagtactcagatcaaacaggct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33194001 |
acaaaggaatctaattcaattaacaaaaagcaaatccttgttatttacatacaaatatgacagaaacaacacaagtagtagtactcagatcaaacatgct |
33193902 |
T |
|
| Q |
115 |
ttggtcagaaagaaagaatcataggtgaggactgcaacagaatatgatgcttaaatatggttagagagtgctttcataacacccac-------tagacac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
33193901 |
ttggtcagaaagaaagaatcataggtgaggactgcaacagaatatgatgc----------ttagagagtgctttcataacacccactagacagtagacac |
33193812 |
T |
|
| Q |
208 |
tagaaagcatatatgaattctgaaaactc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33193811 |
tagaaagcatatatgaattctgaaaactc |
33193783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University