View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17576_low_71 (Length: 226)
Name: NF17576_low_71
Description: NF17576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17576_low_71 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 21 - 208
Target Start/End: Original strand, 29071238 - 29071425
Alignment:
| Q |
21 |
ggaaggaaaagtaaaatgcacgcaaaccaagtgaccagaaatagcttccacggttaactgtattggcaacatactcagctgtcagcttctgttgtctaag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29071238 |
ggaaggaaaagtaaaatgcacgcaaaccaagtgaccagaaatagcttccacggttaactgtattggcaacatactcagctgtcagcttctgttgtctaag |
29071337 |
T |
 |
| Q |
121 |
gtttgatgacagtttcttgaaaggaacattgatgagaatgcttgcatgactatagtaccttatagattgaacatttaacaagaaagct |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29071338 |
gtttgatgatagtttcttgaaaggaacattgatgagtatgcttgcatgactatagtaccttatagattgaacattcaacaagaaagct |
29071425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University