View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17576_low_75 (Length: 204)
Name: NF17576_low_75
Description: NF17576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17576_low_75 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 20 - 188
Target Start/End: Original strand, 7456296 - 7456464
Alignment:
| Q |
20 |
aattgttagttgtgagtgtacaaaaaagacaacaacaccgcatttggtgtgattgatgctcattatgagcaatacattttctacaacttaattatagtaa |
119 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7456296 |
aattgttagttttgagtgtacaaaaaagaccacaacaccgcatttggtgtgattgatgctcattatgagcaatacattttctacaacttaattatagtaa |
7456395 |
T |
 |
| Q |
120 |
tagcaaagaaaagttttctttcttcctcgtgacaattgtaactgaatttatcacatcgactgcgtctgt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7456396 |
tagcaaagaaaagttttctttcttcctcgtgacaattgtaactgaatttatcacatcgactgcatctgt |
7456464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University