View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17577_low_21 (Length: 246)
Name: NF17577_low_21
Description: NF17577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17577_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 46 - 236
Target Start/End: Original strand, 8467151 - 8467341
Alignment:
| Q |
46 |
actgtagctttgctgtaggaggtgggcatactgccaacagaccactgttagcttctctttgtaaagccttcctgatatactattttcttatctgatgagc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8467151 |
actgtagctttgctgtaggaggtgggcatactgccaacagaccactgttagcttctctttgtaaagccttcctgatatactattttcttatctgatgaac |
8467250 |
T |
 |
| Q |
146 |
ttgtgcctaactctaactaccacgagagctatcaagcacaaccagctttctgccctaaatcacagtttcgttttctccctttgtttatatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8467251 |
ttgtgcctaactctaactaccacgagagctatcaagcacaaccagctttctgccctgaatcacagtttcgttttctccctttgtttatatt |
8467341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University