View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17577_low_24 (Length: 234)
Name: NF17577_low_24
Description: NF17577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17577_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 123 - 205
Target Start/End: Original strand, 31042498 - 31042580
Alignment:
| Q |
123 |
gatgaaaataagattggttttgatgattatttagtattagggtacttaaaacaatagtttaatttcaatatattgactatggt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31042498 |
gatgaaaataagattggttttgatgattatttagtattagggtacttaaaacaatagtttaatttcaatatattgactatggt |
31042580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 14 - 64
Target Start/End: Original strand, 31042390 - 31042440
Alignment:
| Q |
14 |
tttttgactcttggatctgaacgtattgtgattgttatattggctatgatg |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31042390 |
tttttgactcttggatctgaacgtattgtgattgttatattggctatgatg |
31042440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University