View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17578_high_17 (Length: 250)
Name: NF17578_high_17
Description: NF17578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17578_high_17 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 9 - 250
Target Start/End: Complemental strand, 48953408 - 48953167
Alignment:
| Q |
9 |
gagatgaatcataagtagtgacatggacattgacatgcttagcataaacagagctaatatgcccacaaccaaggcaggtctagtgttcatcaacattctt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48953408 |
gagatgaatcataagtagtgacatggacattgacatgcttagcataaacagagctaatatgcccacagccaaggcaggtctagtgttcatcaacattctt |
48953309 |
T |
 |
| Q |
109 |
tgcaacaatccaactgcatcacatacatccgaaccataattctcaaaatacttcttctcccattcagtccaatcagaatgatctttagtctttgtttcca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48953308 |
tgcaacaatccaactgcatcacatacatccgaaccataattctcaaaatacttcttctcccattcagtccaatcagaatgatctttagtctttgtttcca |
48953209 |
T |
 |
| Q |
209 |
ccatctcaatctcacggattcgcattctaagaatgatcatgt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48953208 |
ccatctcaatctcacggattcgcattctaagaatgatcatgt |
48953167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University