View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17578_high_18 (Length: 242)
Name: NF17578_high_18
Description: NF17578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17578_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 153 - 227
Target Start/End: Complemental strand, 1709360 - 1709286
Alignment:
| Q |
153 |
gccttctccttgatctctctccgcaaccttcacttccaactgccgcaacgccctcccaaacgctgaagacaaagc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1709360 |
gccttctccttgatctctctccgcaaccttcacttccaactgccccaacgccctcccaaacgctgaagacaaagc |
1709286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 86
Target Start/End: Complemental strand, 1709505 - 1709427
Alignment:
| Q |
8 |
ccaccatcttcttccccatccaaaccaactccgccgctactttctccgccggaacacccccttcacctccctttactct |
86 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1709505 |
ccaccatcttcttcaccatccaaaccaactccgccgccaatttctccgccggaacaccaccttcacctccctttactct |
1709427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University