View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17578_high_7 (Length: 332)
Name: NF17578_high_7
Description: NF17578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17578_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 22 - 264
Target Start/End: Original strand, 51937759 - 51937996
Alignment:
| Q |
22 |
tatcactaacatcaaatgctgttgaaataagaggactatgctggtgatgatccacgtgtgaactactccctttgctggctgggtctcctttcaccacctt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51937759 |
tatcactaacatcaaatgctgttgaaataagaggactatgctggtgatgatccacgtgtgaactactccctttgctggctgggtctcctttcaccacctt |
51937858 |
T |
|
| Q |
122 |
aggtcctgtctcccttgtcaacgacgccaacgattcactgatcgatccattattgattaaacacaaaattagtattaattcaattcatatatagcatcga |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51937859 |
aggtcctgtctcccttgtcaacgacgccaacgattcact----gatccattattaattaaacacaaaattagtattaattcaattcatatatagcatcga |
51937954 |
T |
|
| Q |
222 |
tcatgaatataataatatgtaggtacgtacctgatggattgaa |
264 |
Q |
| |
|
|||| |||||||||||| || ||| ||||||||||||||||| |
|
|
| T |
51937955 |
tcattaatataataata-atatgtaggtacctgatggattgaa |
51937996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University