View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17578_low_26 (Length: 224)
Name: NF17578_low_26
Description: NF17578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17578_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 9 - 207
Target Start/End: Original strand, 12870494 - 12870691
Alignment:
| Q |
9 |
gagagagatgaagtacctcatgtgtcgtgtcttgcttgctgttcatttggttatgcaaaccggattgtaaatcggtgaacttctaacattctcaagaaaa |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
12870494 |
gagagcgatgaagtacctcatgtgtcgtgtcttgcttgctgttcatttggttatgcaaaccggattgtaaatcggtgaacttgtaactttctcaagaaaa |
12870593 |
T |
|
| Q |
109 |
tcggtgaagtttattttgatgaaattgtgaggattggagtacgatggttgggatggaatttcttgaatcaattttaggtacccccttctctcactattt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12870594 |
tcggtgaagtttattttgatgaaattgtgaggattggagtacgattgttgggatggaatttcttgaatcaattttaggta-ccccttctctcactattt |
12870691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 9 - 207
Target Start/End: Original strand, 27765657 - 27765855
Alignment:
| Q |
9 |
gagagagatgaagtacctcatgtgtcgtgtcttgcttgctgttcatttggttatgcaaaccggattgtaaatcggtgaacttctaacattctcaagaaaa |
108 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||| ||||||| |
|
|
| T |
27765657 |
gagagcgatgaagtacctcacgtgtcgtgtcttgcttgctgttcatttggttatgcaaaccggattgtaaataggtgaacttataactttcttaagaaaa |
27765756 |
T |
|
| Q |
109 |
tcggtgaagtttattttgatgaaattgtgaggattggagtacgatggttgggatggaatttcttgaatcaattttaggtacccccttctctcactattt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27765757 |
tcggtgaagtttattttgatgaaattgtgaggattgaagtacgatggttgggatggaatttcttgaatcaattttaggtacccccttctctcactattt |
27765855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 207
Target Start/End: Original strand, 41810794 - 41810866
Alignment:
| Q |
134 |
tgtgaggattggagtacgatggttgggatggaatttcttgaatcaattttaggtacccccttctctcactattt |
207 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||| | ||| |||| |||||||||| | | ||||||||||||| |
|
|
| T |
41810794 |
tgtgaggattggagtacgatggttcagattgaatattttgcatcagttttaggtactcac-tctctcactattt |
41810866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 207
Target Start/End: Complemental strand, 31770520 - 31770448
Alignment:
| Q |
134 |
tgtgaggattggagtacgatggttgggatggaatttcttgaatcaattttaggtacccccttctctcactattt |
207 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||| | ||| |||| |||||||||| | | ||||||||||||| |
|
|
| T |
31770520 |
tgtgaggattggagtacgatggttcagattgaatattttgcatcagttttaggtactcac-tctctcactattt |
31770448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University