View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17579_low_6 (Length: 205)
Name: NF17579_low_6
Description: NF17579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17579_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 16 - 188
Target Start/End: Complemental strand, 36487812 - 36487641
Alignment:
| Q |
16 |
aaaataattaagaaaaaaggaattaacccctcaaattaaatcatgcnnnnnnnnnccccttgaaatatgttagataattcaaaatttgtatataactaag |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36487812 |
aaaaaaattaagaaaaaaggaattaacccctcaaattaaatcatgctttttttt-ccccttgaaatatgttagataattcaaaatttgtatataactaag |
36487714 |
T |
|
| Q |
116 |
aaagatcattatttaggttcaggaataaaaaattgcagaattgaatatgaaagcaaaacccttgaatcatatg |
188 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36487713 |
aaagatcattatttaggttctggaataaaaaattgcagaattgaatatgaaagcaaaacccttgaatcatatg |
36487641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University