View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1757_high_12 (Length: 265)
Name: NF1757_high_12
Description: NF1757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1757_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 10 - 246
Target Start/End: Original strand, 23142589 - 23142825
Alignment:
| Q |
10 |
gcacagacttttatggaattgttgttggtctatcgtaaacatgggaggttacaacttgcaagggtagtctcattgtgcttaagatggatttaaaatgatg |
109 |
Q |
| |
|
||||||||||||||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23142589 |
gcacagacttttatgaaatcattgttggtcaatcgtaaacatgggaggttacaacttgcaagggtagtctcattgtgcttaagatggatttaaaatgatg |
23142688 |
T |
 |
| Q |
110 |
acatcttagaagggtgccaatctacaaaatgattttgaacaaatgtttatgatatccacattttctttatggacaaaggttcttttgcacctataaaatt |
209 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23142689 |
acatcttagaagggtgccaatcttcaaaatgattttgaacaaatgtttatgacatccacattttctttatggacaaaggttcttttgcacctataaaatt |
23142788 |
T |
 |
| Q |
210 |
atctccaaaggaaacattttaatgttcatgtcccctt |
246 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23142789 |
atctccaaaggaaatattttaatgttcatgtcccctt |
23142825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University