View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1757_high_15 (Length: 246)
Name: NF1757_high_15
Description: NF1757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1757_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 227
Target Start/End: Complemental strand, 40057615 - 40057397
Alignment:
| Q |
13 |
gaagaatatgagctgcatatgattattcaaactaaaagagggagtta----catggattgaaattccagattcaaagcaagaggattcacataacgtgag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40057615 |
gaagaatatgagctgcatatgattattcaaactaaaagagggagttaattacatggattgaaattccagattcaaagcaagaggattcacataacgtgag |
40057516 |
T |
 |
| Q |
109 |
ggaattgattgatgtgaaaactattttcttgtatggacagcttgaggaacaaattcatatgactcaaccagagctttttattaagaaggatgaagaagac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40057515 |
ggaattgattgatgtgaaaactattttcttgtatggacagcttgaggaacaaattcatatgactcaaccagagctttttactaagaaggatgaagaagac |
40057416 |
T |
 |
| Q |
209 |
aaaatatgcttgttgaaaa |
227 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40057415 |
aaaatatgcttgttgaaaa |
40057397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University