View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1757_high_19 (Length: 212)
Name: NF1757_high_19
Description: NF1757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1757_high_19 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 42492461 - 42492677
Alignment:
| Q |
1 |
ttcttgcaaatttccttgtccacatgtgtcgctctttcataagatatagttatattcaacgaagttttttaaaaatgattataacaattttccatgatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42492461 |
ttcttgcaaatttccttgtccacatgtgtcgctctttcataagatatagttatattcaacgaagttttttaaaaatgattataacaattttccacgatag |
42492560 |
T |
 |
| Q |
101 |
taca-----cacgtaatattgatgataaaatttcgtcattaattaacttatactttaaataatttgacatatcaaacctatcaataaaacgattggctga |
195 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42492561 |
tacactacacacgtaatattgatgataaaatttcgtcattaattaacttatactttaaataatttgacatatcaaacctatcaataaaacgattggctga |
42492660 |
T |
 |
| Q |
196 |
ttcacaaaaaggtcaca |
212 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
42492661 |
ttcacaaaaacgtcaca |
42492677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University