View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1757_low_10 (Length: 295)
Name: NF1757_low_10
Description: NF1757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1757_low_10 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 295
Target Start/End: Original strand, 8768272 - 8768549
Alignment:
| Q |
18 |
tgcggcatccgaacgttgttacacttgctggatattgtgcagaacatggccagcggcttctaatttatgaatatattggaaatggaaatttacacgacat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8768272 |
tgcggcatccgaacgttgttacacttgctggatattgtgcagaacatggccagcggcttctaatttatgaatatattggaaatggaaatttacatgacat |
8768371 |
T |
 |
| Q |
118 |
gctccattttgccgaagagagcagtaaagctttaccttggaatgctcgtgtacgcatagctcttggcaccgcccgggccttagagtaagtatcataccca |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8768372 |
gctccattttgccgaagaaagcagtaaagctttaccttggaatgctcgtgtacgcatagctcttggcaccgcccgggccttagagtaagtatcataccca |
8768471 |
T |
 |
| Q |
218 |
tctggcaacatattaagaacgtgtttggattcacggagattttgttgaagcattttgcaactgctacccttcaaagct |
295 |
Q |
| |
|
|||| |||||||||||| || ||||||||||||||| ||||||||||||||||||||||| |||||| |||| ||||| |
|
|
| T |
8768472 |
tctgacaacatattaagtacatgtttggattcacggtgattttgttgaagcattttgcaaatgctacacttcgaagct |
8768549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University