View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1757_low_17 (Length: 246)

Name: NF1757_low_17
Description: NF1757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1757_low_17
NF1757_low_17
[»] chr4 (1 HSPs)
chr4 (13-227)||(40057397-40057615)


Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 227
Target Start/End: Complemental strand, 40057615 - 40057397
Alignment:
13 gaagaatatgagctgcatatgattattcaaactaaaagagggagtta----catggattgaaattccagattcaaagcaagaggattcacataacgtgag 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||    
40057615 gaagaatatgagctgcatatgattattcaaactaaaagagggagttaattacatggattgaaattccagattcaaagcaagaggattcacataacgtgag 40057516  T
109 ggaattgattgatgtgaaaactattttcttgtatggacagcttgaggaacaaattcatatgactcaaccagagctttttattaagaaggatgaagaagac 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
40057515 ggaattgattgatgtgaaaactattttcttgtatggacagcttgaggaacaaattcatatgactcaaccagagctttttactaagaaggatgaagaagac 40057416  T
209 aaaatatgcttgttgaaaa 227  Q
    |||||||||||||||||||    
40057415 aaaatatgcttgttgaaaa 40057397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University