View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1757_low_19 (Length: 240)
Name: NF1757_low_19
Description: NF1757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1757_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 38 - 220
Target Start/End: Complemental strand, 46180134 - 46179952
Alignment:
| Q |
38 |
caataaacgtgagtgagtgagtgagtcgaagtcgacccacttgggtttttagccagctttcttctactaagcccaatgttgctttgctttactaagtcag |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
46180134 |
caataaacgtgagtgagtgagtgagtcgaagtcgacccacttgagtttttagccagctttcttctactaagcccaacgttgctttgctttactaagtcgg |
46180035 |
T |
 |
| Q |
138 |
cttannnnnnnnnnnnnaaatttggggttatgttatatatcacatccccattcctcctttctccctttccccactattaggtc |
220 |
Q |
| |
|
||| ||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
46180034 |
cttcattttcattttttaaatttggggttatgttatatatcacacccccattcctcctttctccacttccccaatattaggtc |
46179952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University