View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1757_low_20 (Length: 225)
Name: NF1757_low_20
Description: NF1757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1757_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 104 - 218
Target Start/End: Original strand, 14597098 - 14597212
Alignment:
| Q |
104 |
gttgtcttttcatatataatattgtatataagtacaaaaatattttttatgacttatatgtttgtgtttgacaaagtatacataccaacaagaaatgaca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14597098 |
gttgtcttttcatatataatattgtatataagtacaaaaatattttttatgacttatatgtttgtgtttgacaaagtatacataccaacaagaaatgaca |
14597197 |
T |
|
| Q |
204 |
gacacaggttctgct |
218 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
14597198 |
gacacagattctgct |
14597212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 14596995 - 14597047
Alignment:
| Q |
1 |
ataaatccatcccactctttctccccattctgtcttgtcttcatacctacatg |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14596995 |
ataaatccatcccactctttctccccattctgtcttgtcttcatacctacatg |
14597047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 14611575 - 14611523
Alignment:
| Q |
1 |
ataaatccatcccactctttctccccattctgtcttgtcttcatacctacatg |
53 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||| |||||||||| |
|
|
| T |
14611575 |
ataaatccatcccactctgtctccccattctgtcttctcttcgtacctacatg |
14611523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 2 - 47
Target Start/End: Original strand, 12192814 - 12192859
Alignment:
| Q |
2 |
taaatccatcccactctttctccccattctgtcttgtcttcatacc |
47 |
Q |
| |
|
||||||||||| ||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
12192814 |
taaatccatccaactctatctccccattcggtcttatcttcatacc |
12192859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University