View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17580_high_23 (Length: 227)
Name: NF17580_high_23
Description: NF17580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17580_high_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 27324769 - 27324986
Alignment:
| Q |
1 |
tgggttgctgggtgggtgtgtttgatatgttactaaatcaataatgggtgggtgttattagcagtatatgtatatatatattnnnnnnnnnnnnnnnnnt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
27324769 |
tgggttgctgggtgggtgtgtttgatatgttactaaagcaatagtgggtgggtgttattagcagtatat----atatatattaaaaaagtttagaaaaat |
27324864 |
T |
|
| Q |
101 |
ttatgcatgcaggagcccccacaatcatatgagtggctcc-----tgttatggatccaaattttgttggattcgaaacaacctgcaaattcgatgaccat |
195 |
Q |
| |
|
|| |||||| |||||||||||||||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27324865 |
ttgtgcatgtaggagcccccacaatcatgtgagtggctccgcccctgctatggatccaaattttgttggattcgaaacaacctgcaaattcgatgaccat |
27324964 |
T |
|
| Q |
196 |
ggtaacctaatctttctctctg |
217 |
Q |
| |
|
| |||||||||||||||||||| |
|
|
| T |
27324965 |
gttaacctaatctttctctctg |
27324986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 140
Target Start/End: Original strand, 12587768 - 12587804
Alignment:
| Q |
104 |
tgcatgcaggagcccccacaatcatatgagtggctcc |
140 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
12587768 |
tgcaggcaggagcccccacaatcatgtgagtggctcc |
12587804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 144 - 217
Target Start/End: Original strand, 41596586 - 41596659
Alignment:
| Q |
144 |
tatggatccaaattttgttggattcgaaacaacctgcaaattcgatgaccatggtaacctaatctttctctctg |
217 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
41596586 |
tatggatccgaattttgtcggattcgaaacaacctacaaattcgatgaccatggtaacttaatccttctctctg |
41596659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 144 - 217
Target Start/End: Original strand, 28916174 - 28916247
Alignment:
| Q |
144 |
tatggatccaaattttgttggattcgaaacaacctgcaaattcgatgaccatggtaacctaatctttctctctg |
217 |
Q |
| |
|
||||||||| |||||||||| |||||||| |||| ||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
28916174 |
tatggatccgaattttgttgatttcgaaaccacctacaaattcgatgaccaaggtaacctaatccttctctctg |
28916247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 140
Target Start/End: Complemental strand, 6900386 - 6900350
Alignment:
| Q |
104 |
tgcatgcaggagcccccacaatcatatgagtggctcc |
140 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
6900386 |
tgcaggcaggagcccccacaatcatgtgagtggctcc |
6900350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University