View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17580_low_26 (Length: 207)
Name: NF17580_low_26
Description: NF17580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17580_low_26 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 33901998 - 33902199
Alignment:
| Q |
1 |
taaagatttctatgaacttgttgctgcagcagaggcaaggcttcttctacttttaatattcttctactaaatcaatggtctattcatagttgtaacatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33901998 |
taaagatttctatgaacttgttgctgcagcagaggcaaggcttcttctacttttaatattcttctactaaatcaatggtctattcatagttgtaacatt- |
33902096 |
T |
 |
| Q |
101 |
tattgttcaataatgttgattgttatatctacatcattaggtgaatagtgaacatccaatagcaaagtccattgttgatcatgccaaaaatatcacacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33902097 |
----gttcaataatgttgattgttatatctacatcattaggtgaatagtgaacatccaatagcaaagtccattgttgatcatgccaaaaatatcacacaa |
33902192 |
T |
 |
| Q |
201 |
gatgaac |
207 |
Q |
| |
|
||||||| |
|
|
| T |
33902193 |
gatgaac |
33902199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University