View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17581_high_21 (Length: 291)

Name: NF17581_high_21
Description: NF17581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17581_high_21
NF17581_high_21
[»] chr5 (1 HSPs)
chr5 (27-269)||(26562070-26562311)


Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 27 - 269
Target Start/End: Original strand, 26562070 - 26562311
Alignment:
27 gagcttatgaaatgatcacatgcaaactgaaaataggaatacaaacattcattgaagtatttttgtttatacatgcctaggtgcctcgtccgtagcaagg 126  Q
    ||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||    
26562070 gagctcatgaaatgatcacatgcaaactgaaaataggaaaacaaacattcattgaagtatttttgtttatacatgcatgggtgcctcgtccgtagcaagg 26562169  T
127 cagtggttttggtgtccctgtggcacagcagggcgacttgcttgagcttttgcacgacatgaatgaataaacggtccgtatacgacaaaattgatgcaca 226  Q
      ||||||||||||||||| ||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
26562170 tggtggttttggtgtccctatggcacgacagggcgacttgcttgagcttttgcacgacatgaatgaataaacggtccgtatacgacgaaattgatgcaca 26562269  T
227 tcacatatatattggggaagaagattgaggtttgtggcttggt 269  Q
    ||||||||||||| ||||||||| | |||||||||||||||||    
26562270 tcacatatatatt-gggaagaagttcgaggtttgtggcttggt 26562311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University