View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17581_low_22 (Length: 291)
Name: NF17581_low_22
Description: NF17581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17581_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 27 - 269
Target Start/End: Original strand, 26562070 - 26562311
Alignment:
| Q |
27 |
gagcttatgaaatgatcacatgcaaactgaaaataggaatacaaacattcattgaagtatttttgtttatacatgcctaggtgcctcgtccgtagcaagg |
126 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
26562070 |
gagctcatgaaatgatcacatgcaaactgaaaataggaaaacaaacattcattgaagtatttttgtttatacatgcatgggtgcctcgtccgtagcaagg |
26562169 |
T |
 |
| Q |
127 |
cagtggttttggtgtccctgtggcacagcagggcgacttgcttgagcttttgcacgacatgaatgaataaacggtccgtatacgacaaaattgatgcaca |
226 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26562170 |
tggtggttttggtgtccctatggcacgacagggcgacttgcttgagcttttgcacgacatgaatgaataaacggtccgtatacgacgaaattgatgcaca |
26562269 |
T |
 |
| Q |
227 |
tcacatatatattggggaagaagattgaggtttgtggcttggt |
269 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||||||||||| |
|
|
| T |
26562270 |
tcacatatatatt-gggaagaagttcgaggtttgtggcttggt |
26562311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University