View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17581_low_26 (Length: 277)
Name: NF17581_low_26
Description: NF17581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17581_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 17 - 216
Target Start/End: Original strand, 1502132 - 1502326
Alignment:
| Q |
17 |
aagatgttcattttcttatggagcttattcaagtatagttaccttctgtttcacctctttcttatgttataacatacatgcatgcatgtcatttaaatcc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1502132 |
aagatgttcattttcttatggagcttattcaagtatagttaccttctgtttcacctctttcttatgttataacat----gcatgcatgtcatttaaatcc |
1502227 |
T |
 |
| Q |
117 |
aaaaatttaactcataaagttagtattatgcaaatttatttcattgtgnnnnnnnnnnnnnggagtagtgtaggttgagttacatatagcaagaagatgg |
216 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1502228 |
aaaaatttaactcataaacttagtattatgaaaatttatttcattgtgtttttttttttt-ggtgtagtgtaggttgagttacatatagcgagaagatgg |
1502326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University