View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17581_low_32 (Length: 247)
Name: NF17581_low_32
Description: NF17581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17581_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 20 - 226
Target Start/End: Complemental strand, 48059672 - 48059466
Alignment:
| Q |
20 |
atcaaggtgggttctgattgaagtttgtagccctaacatccaaccaaatataatcagcatgataccaatcccgtaagatatggagtgtggtctcaatctc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48059672 |
atcaaggtgggttctgattgaagtttgtagccctaacatccaaccaaatataatcagcatgataccaatcccgtaagatatggagtgtggtctcaatctc |
48059573 |
T |
 |
| Q |
120 |
atttgattttgcatatctgatctggagagaaataaatatagtaacaaagcaatatcatagctcattagtcagcatgtggtcatgaagtcaaatccaacca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48059572 |
atttgattttgcatatctgatctggagagaaataaatatagtaacaaagcaatatcatagctcattagtcagcatgtggtcatgaagtcaaatccaacca |
48059473 |
T |
 |
| Q |
220 |
gtagtca |
226 |
Q |
| |
|
||||||| |
|
|
| T |
48059472 |
gtagtca |
48059466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University