View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17581_low_37 (Length: 231)
Name: NF17581_low_37
Description: NF17581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17581_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 13 - 207
Target Start/End: Complemental strand, 32903894 - 32903700
Alignment:
| Q |
13 |
aatatcaagaatgtgattcaagacaaaatatattaatagaatgcttatttttgatcacgttgagacttgaagctattcttggtataacttttctagcttc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32903894 |
aatatcaagaatgtgattcaagacaaaatatattaatagaaagcttatttttgatctcgttgagacttgaagctattcttggtataacttttctagcttc |
32903795 |
T |
 |
| Q |
113 |
ctgcttgtccttttctgaatctaatgaatctatacattatatgtgaaattatgagggaaacgttggnnnnnnnnagaaatagaccttgctggcgt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32903794 |
ctgcttgtccttttctgaatctaatgaatctatacattatatgtgaaattatgagggaaacgttggttttttttagaaatagaccttgctggcgt |
32903700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University