View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17581_low_39 (Length: 228)
Name: NF17581_low_39
Description: NF17581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17581_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 3809906 - 3809706
Alignment:
| Q |
1 |
cagtattatgcatggaagtaaacttcggatcatgaggcgagctgttacggtcgagcattgacaaacaaaaccttaaacgagcaatcatattttcctctat |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3809906 |
cagtattgtgcatggaagtaaacttcggatcatgaggcgagctgttacggtcgagcattgacaaacaaaaccttaaacgagcaatcatattttcctcttt |
3809807 |
T |
 |
| Q |
101 |
taaatatggcttaagtgtacttgaatggagtcgtataactccggacttttgcagccttatcaatgatgtcttaggaattttcagagcaagagatagagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3809806 |
taaatatggcttaagtgtacttgaatggcgtcgtataactccggacttttgcagccttatcaatgatgtcttaggaattttcagagcaagagatagagat |
3809707 |
T |
 |
| Q |
201 |
c |
201 |
Q |
| |
|
| |
|
|
| T |
3809706 |
c |
3809706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University