View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17581_low_40 (Length: 227)
Name: NF17581_low_40
Description: NF17581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17581_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 53 - 221
Target Start/End: Original strand, 33028389 - 33028556
Alignment:
| Q |
53 |
tgactatgaattgagacattatgcatccacatttgaaagaacctctaactccttatcacttagcttaaactggttgagctgtacgtgtttgattattaat |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
33028389 |
tgactatgaattgagacattatgcatccacatttgaaagaacctctaa-tccttatcacttagcttaaaccggttgagctgtccgtgtttgattattaat |
33028487 |
T |
 |
| Q |
153 |
atactatgataataatcaactgttgaattaatgaaactcatcgtatccggttgagctgttgtatatata |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33028488 |
atactatgataataatcaactgttgaattaatgaaactcatcgtatccggttgagctgttgtatatata |
33028556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 33028337 - 33028365
Alignment:
| Q |
1 |
aaatataaaagtattttatgattttgttc |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33028337 |
aaatataaaagtattttatgattttgttc |
33028365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University